MIR150 is a microRNA that has been studied in various contexts [PMC6269310]. In one study, the dual regulatory mechanisms of MIR150 expression were investigated, including direct transcriptional activation by MYC and the post-transcriptional inhibition of miR-150 maturation by MYC-driven Lin28 [PMC6269310]. However, the data did not show repression of miR-150 maturation blockade following BCR-ABL1 inhibition in CML cells [PMC6269310]. Another study found that a proximal peak in MIR150 expression coincided with the miR-150 sequence and quickly disappeared after stimulation in naive and memory resting T lymphocytes, suggesting a possible role in the direct control of MIR150 expression [PMC8865640]. Additionally, MIR150 has been identified as one of several free circulating miRNAs that have been isolated in plasma/serum before HCT (hematopoietic cell transplantation), suggesting a possible prognostic use in GVHD (graft-versus-host disease) [PMC9720327]. Furthermore, liver tumor-derived lncRNAs (such as TUC339), circRNAs (such as hsa_circ_0074854), and miRNAs (such as MIR150) have been implicated as critical signaling mediators that orchestrate macrophage M1/M2 polarization [PMC9648394].
c u - AC U U - g ucccca gg cccugUCUCCCA CCU GUACCAG G cug g |||||| || |||||||||||| ||| ||||||| | ||| aggggu cc ggGACAGGGGGU GGA CAUGGUC c gac c c - a CC - c a u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000451 |
Description | Homo sapiens hsa-miR-150-5p mature miRNA |
Sequence | 16 - UCUCCCAACCCUUGUACCAGUG - 37 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004610 |
Description | Homo sapiens hsa-miR-150-3p mature miRNA |
Sequence | 51 - CUGGUACAGGCCUGGGGGACAG - 72 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|