miRBase entry: hsa-mir-150

Stem-loop hsa-mir-150


Accession
MI0000479
Symbol
HGNC: MIR150
Description
Homo sapiens hsa-mir-150 precursor miRNA mir-150
Gene
family?
RF00767; mir-150

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR150 is a microRNA that has been studied in various contexts [PMC6269310]. In one study, the dual regulatory mechanisms of MIR150 expression were investigated, including direct transcriptional activation by MYC and the post-transcriptional inhibition of miR-150 maturation by MYC-driven Lin28 [PMC6269310]. However, the data did not show repression of miR-150 maturation blockade following BCR-ABL1 inhibition in CML cells [PMC6269310]. Another study found that a proximal peak in MIR150 expression coincided with the miR-150 sequence and quickly disappeared after stimulation in naive and memory resting T lymphocytes, suggesting a possible role in the direct control of MIR150 expression [PMC8865640]. Additionally, MIR150 has been identified as one of several free circulating miRNAs that have been isolated in plasma/serum before HCT (hematopoietic cell transplantation), suggesting a possible prognostic use in GVHD (graft-versus-host disease) [PMC9720327]. Furthermore, liver tumor-derived lncRNAs (such as TUC339), circRNAs (such as hsa_circ_0074854), and miRNAs (such as MIR150) have been implicated as critical signaling mediators that orchestrate macrophage M1/M2 polarization [PMC9648394].

Literature search
317 open access papers mention hsa-mir-150
(2132 sentences)

Sequence

58970 reads, 1228 reads per million, 108 experiments
cuccccauggcccugUCUCCCAACCCUUGUACCAGUGcugggcucagaccCUGGUACAGGCCUGGGGGACAGggaccuggggac
.((((((.((((((((((((((..(((.(((((((.((((....))).).))))))))))..)))))))))))).)))))))).

Structure
c      u  -            AC   U       U -   g 
 ucccca gg cccugUCUCCCA  CCU GUACCAG G cug g
 |||||| || ||||||||||||  ||| ||||||| | |||  
 aggggu cc ggGACAGGGGGU  GGA CAUGGUC c gac c
c      -  a            CC   -       c a   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr19: 49500785-49500868 [-]

Disease association
hsa-mir-150 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-150 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-150 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-150-5p

Accession MIMAT0000451
Description Homo sapiens hsa-miR-150-5p mature miRNA
Sequence 16 - UCUCCCAACCCUUGUACCAGUG - 37
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-150-3p

Accession MIMAT0004610
Description Homo sapiens hsa-miR-150-3p mature miRNA
Sequence 51 - CUGGUACAGGCCUGGGGGACAG - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739