MIR184 is a genetic mutation that has been identified in a limited number of genes [PMC6920454]. It is associated with hepatocellular carcinoma (HCC) cells, which show significant changes in the expression profiles of several oncogenic miRNAs [PMC9741442]. These miRNAs include miR21, miR221/222, miR224, miR17-5p/20a, miR10b, miR106b, miR151-5p, miR155, and miR181a/181b [PMC9741442]. These changes in expression profiles suggest that MIR184 and the other identified oncogenic miRNAs may play a role in the development and progression of HCC [PMC9741442]. However, it is important to note that while there have been numerous linkage loci identified in relation to HCC and genetic mutations have been reported in a limited number of genes including MIR184 and DOCK97 [PMC6920454], there is still much to be understood about the genetic factors contributing to HCC development. Further research is needed to fully elucidate the role of MIR184 and other genetic mutations in HCC.
c g c c a c - ug cagucac u cccuuauca uuuucc g ccagc uuug a ||||||| | ||||||||| |||||| | ||||| |||| guuagug a GGGAAUAGU AAGAGG C GGUug gaau c a g U C - A u gu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000454 |
Description | Homo sapiens hsa-miR-184 mature miRNA |
Sequence | 53 - UGGACGGAGAACUGAUAAGGGU - 74 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|