MIR188 is a microRNA that is up-regulated in aged mice and humans and has been found to play a role in bone metabolism [PMC6158877]. It directly targets histone deacetylase 9 (Hdac9) and RPTOR independent companion of MTOR complex 2 (Rictor) mRNAs [PMC6158877]. Overexpression of MIR188 in osteoprogenitors leads to age-associated bone loss and fat accumulation in bone marrow, while mice lacking MIR188 show a decrease in age-associated bone loss and fat accumulation [PMC6158877]. The copy number and DNA methylation level at the MIR188 locus are minimally altered in STAD samples [PMC6537442]. The region upstream of the MIR188 locus contains several signal transducer and activator of transcription (STAT) binding sites, suggesting potential regulatory elements [PMC6537442]. Synthetic oligo RNAs targeting MIR188 were used for experimental purposes [PMC6353185]. MIR188 is specifically enriched in neurons but down-regulated in astrocytes [PMC6434090]. Real-time PCR was used to analyze the expression levels of GAPDH, Bcl-2, and MIR188 genes [PMC5242199]. Additionally, MIR188 has been implicated in Hcy-induced cardiac remodeling [PMC5147974]. Knocking out MIR188 reduces age-related cortical bone loss, trabecular bone loss, and marrow fat deposition in mice models [PMC8327488]. The genomic location of the rat MIR188 gene was determined to be upstream from the Clcn5 gene on the X-chromosome [PMC5052619]. miR532 inhibits TERT expression while miR168, miR397, and MIR188 are enhanced or suppressed depending on the plant species studied [PMC8253104] . Finally, miR130a and miR149-3p promote osteogenic differentiation while MIR188 is involved in the age-related switch to adipogenesis in BMSCs [PMC9391248].
u - uc ca UC GU -ugag u gcuc cc ucu CA CCUUGCAUG GGAGGG c u |||| || ||| || ||||||||| |||||| | u cgag gg agg GU GGGACGUAC CCUCcc g c c c -u AC UU AC caaaa u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000457 |
Description | Homo sapiens hsa-miR-188-5p mature miRNA |
Sequence | 15 - CAUCCCUUGCAUGGUGGAGGG - 35 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004613 |
Description | Homo sapiens hsa-miR-188-3p mature miRNA |
Sequence | 54 - CUCCCACAUGCAGGGUUUGCA - 74 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|