miRBase entry: mmu-mir-96

Stem-loop mmu-mir-96


Accession
MI0000583
Symbol
MGI: Mir96
Description
Mus musculus mmu-mir-96 precursor miRNA mir-96
Gene
family?
RF00669; mir-96

Literature search
104 open access papers mention mmu-mir-96
(900 sentences)

Sequence

38572 reads, 214 reads per million, 95 experiments
ccaguaccaucugcuuggccgauUUUGGCACUAGCACAUUUUUGCUugugucucuccgcugugagCAAUCAUGUGUAGUGCCAAUAUgggaaaagcgggcugcugc
.(((((...(((((((..((.((.(((((((((.(((((..(((((((((......)))...))))))..)))))))))))))).)).))..))))))).))))).

Structure
c     cca       gg  g  U         G     UU      ---   uc 
 cagua   ucugcuu  cc au UUGGCACUA CACAU  UUGCUu   gug  u
 |||||   |||||||  || || ||||||||| |||||  ||||||   |||   
 gucgu   gggcgaa  gg UA AACCGUGAU GUGUA  AACgag   cgc  c
c     --c       aa  g  U         -     CU      ugu   cu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr6: 30169446-30169551 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-96
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-96-5p

Accession MIMAT0000541
Description Mus musculus mmu-miR-96-5p mature miRNA
Sequence 24 - UUUGGCACUAGCACAUUUUUGCU - 46
Evidence experimental
cloned [1-3], Northern [1], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-96-3p

Accession MIMAT0017021
Description Mus musculus mmu-miR-96-3p mature miRNA
Sequence 66 - CAAUCAUGUGUAGUGCCAAUAU - 87
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275