Stem-loop hsa-mir-381

Accession

MI0000789

Symbol

HGNC: MIR381

Description

Homo sapiens hsa-mir-381 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR381 is a miRNA that has been studied in various contexts. In mice, the Adar K999N mutation resulted in lower levels of editing on the 5-HTR2c A, B, and D and MIR381 editing sites compared to the Adar D1113H mutation [PMC9714073]. In mouse brain endothelial cell line bEnd.3, MIR381 was found to be induced by HHcy [PMC6651274]. In gastric cancer cells, MIR381 was found to have a coupling rate with USP15 [PMC4761210]. MIR381 has also been implicated in mantle cell lymphoma and RTT-mouse models [PMC4761210] [PMC8595945]. Differential expression of MIR381 has been observed in PANC-1 cells and A549/CDDP cells [PMC3849454] [PMC7211148]. However, no miRNA response elements (MREs) for MIR381 were found in the guinea pig Abcb1 isoform 1's 3'UTR [PMC4213008]. The miR655 cluster contains several miRNAs including MIR381 that have available expression data [PMC7465874] [PMC10148110]. In prostate cancer cells, MIR381 is associated with RELN and the PI3K-AKT-MTOR axis and downregulates AR expression to suppress proliferation and progression of cancer cells [PMC8939209]. Additionally, pathways related to cancer were downregulated by MIR381 in rat models of renal ischemia reperfusion injury [PMC8484575]. Finally, editing of NEIL1 and MIR381 promoted the growth of A459 lung cancer cells[ PMC8997934]..

Literature search

72 open access papers mention hsa-mir-381
(408 sentences)

Sequence

11272 reads, 109 reads per million, 108 experiments

uacuuaaAGCGAGGUUGCCCUUUGUAUAUucgguuuauugacauggaaUAUACAAGGGCAAGCUCUCUGUgagua
((((((.((.(((.((((((((.((((((((.((........)).)))))))))))))))).))).)).))))))

Structure

      a  C   G        U        g  uua 
uacuua AG GAG UUGCCCUU GUAUAUuc gu   u
|||||| || ||| |||||||| |||||||| ||    
augagU UC CUC AACGGGAA CAUAUaag ua   u
      G  U   G        -        g  cag 

Annotation confidence High

Genome context

chr14: 101045920-101045994 [+]

Clustered miRNAs

18 other miRNAs are < 10 kb from hsa-mir-381

Disease association

hsa-mir-381 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-381-3p

• Accession: MIMAT0000736
• Description: Homo sapiens hsa-miR-381-3p mature miRNA
• Sequence: 49 - UAUACAAGGGCAAGCUCUCUGU - 70
• Evidence: experimental ; cloned [1-2], SOLiD [3]

Mature hsa-miR-381-5p

• Accession: MIMAT0022862
• Description: Homo sapiens hsa-miR-381-5p mature miRNA
• Sequence: 8 - AGCGAGGUUGCCCUUUGUAUAU - 29
• Evidence: experimental ; SOLiD [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


3. PubMed ID: 22282338
   Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
   "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
   "RNA (2012) 18:472-484