MIR382 is a candidate miRNA that has been identified as a potential modulator of KIF14 mRNA levels in ovarian cancer (OvCa) tumors [PMC3953446]. It has also been shown to reduce the expression of SLC7A11, promoting ferroptosis [PMC8572460]. Inhibition of MIR382 can increase PTEN levels, leading to the inhibition of the PI3K/AKT/mTOR pathway and a decrease in HIF-1α [PMC4081109]. Increased expression of MIR382 has been found to inhibit HIV-1 replication in macrophages through sequence complementarity and binding to viral mRNA [PMC4406127]. Overexpression of MIR382 can decrease voluntary intake and preference for ethanol [PMC5836055]. Decreased expression of MIR382 has been associated with poor outcomes in osteosarcomas [PMC3953446]. In a study involving BMSCs, silencing HDAC3 resulted in a decrease in exosomal expression of miR380 and MIR382 [PMC6883144]. Increased expression of MIR382 has also been observed in ON-derived cells from individuals with schizophrenia and bipolar disorder, suggesting its potential role in these psychiatric disorders [PMC4354342] [PMC7527411]. MIR382 is an important miRNA that plays diverse roles in various biological processes, including cancer development, viral replication inhibition, alcohol preference modulation, and psychiatric disorders. Further research is needed to fully understand the mechanisms by which MIR382 exerts its effects.
u -A UG - uuu uacu gaagaGA GUUGUUCGUGG GAUUCG c a |||| ||||||| ||||||||||| |||||| | c auga cuuuuUU CAACAGGCACU CUAAgc g u - CA UA a uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000737 |
Description | Homo sapiens hsa-miR-382-5p mature miRNA |
Sequence | 11 - GAAGUUGUUCGUGGUGGAUUCG - 32 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
Accession | MIMAT0022697 |
Description | Homo sapiens hsa-miR-382-3p mature miRNA |
Sequence | 47 - AAUCAUUCACGGACAACACUU - 67 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|