MIR383 is a bovine miRNA that has been studied for its diagnostic and prognostic value in various diseases, including mastitis, hepatocellular carcinoma (HCC), islet dysfunction in obesity, and non-small cell lung cancer (NSCLC) [PMC8532728] [PMC5339660] [PMC5362709] [PMC3092095] [PMC7236805]. It has been shown to exhibit sensitivity and specificity greater than 80% for differentiating between California Mastitis Test positive (CMT+) milk and normal milk [PMC8532728]. In HCC cell lines, transfection with MIR383 mimics resulted in changes in metabolic parameters related to glycolysis [PMC5339660]. In islets of diet-induced obese mice, MIR383 levels were found to be decreased compared to normal mice [PMC7236805]. MIR383 has also been shown to be involved in the regulation of other miRNAs, such as miR134, miR382, and miR182 in the hippocampus [PMC6647430]. Additionally, MIR383 has been studied in the context of ES cell differentiation and its expression pattern was found to be correlated with Gadd45g expression [PMC4240536]. In NSCLC patients, elevated levels of circulating miRNAs including MIR383 were associated with improved survival outcomes [PMC5505543] [PMC9372196]. Furthermore, upregulation of MIR383 was found to suppress gastric cancer development by inhibiting cyclin E2 expression [PMC9608775]. The genomic region containing MIR383 has also been associated with frequent copy number losses (CNLs) in tumor suppressor genes (TSGs) such as TP53 and other microRNAs on chromosome 8p22 locus including MIR320A and MIR497 were also found near MIR383 [PMC5001246]. MIR383 has been identified as a diagnostic biomarker for head and neck cancers [PMC8446523]. The E2F transcription factor indirectly regulates MIR383 and its positional candidate genes, including SGCZ, TRPM7, and MARCH11 [PMC6624949].
-c A AA A uug gga cuc uc GAUCAG GGUG UUGUGGCU ggu u ||| || |||||| |||| |||||||| ||| gag AG CUGGUC UCAC GACAccga cua a aa A CG - --- auu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000738 |
Description | Homo sapiens hsa-miR-383-5p mature miRNA |
Sequence | 7 - AGAUCAGAAGGUGAUUGUGGCU - 28 |
Evidence |
experimental
cloned [2], Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026485 |
Description | Homo sapiens hsa-miR-383-3p mature miRNA |
Sequence | 50 - ACAGCACUGCCUGGUCAGA - 68 |
Evidence |
experimental
Illumina [3] |
|