Mmu-mir-378 is a differentially expressed miRNA that plays important roles in immune function, signal pathway induction, and nutrition metabolism [PMC4136864]. It has been found to have a target site in the mRNA corresponding to the BCL7A gene [PMC2684643]. Mmu-mir-378 is one of the 10 differentially expressed miRNAs with the highest degree in a network analysis [PMC6833270]. It has also been identified as one of the miRNAs that are upregulated in white adipose tissue (WAT) in response to high-fat diet (HFD) feeding [PMC4571067]. Mmu-mir-378 is downregulated during HFD-induced obesity, which is consistent with previous studies [PMC3319598]. It has been shown to have potential binding sites with the 3'-UTR of Caspase-3 mRNA [PMC5037706]. Mmu-mir-378 is one of the miRNAs that are downregulated in baicalin-treated mice compared with UVB irradiated mice and predicted to be related to DNA repair signaling pathway [PMC3597329]. It has also been identified as one of the dominantly expressed miRNAs in Brucella-infected cells and mock-infected cells [PMC3421232]. Mmu-mir-378 is T3-responsive and its expression can be induced by T3 treatment in primary mouse hepatocytes [PMC7977473]. Overall, mmu-mir-378 plays diverse roles and its expression can be regulated by various factors.
g C U gu acc agg CU CUGACUCCAGGUCC GUGU u u ||| || |||||||||||||| |||| | ucc GA GACUGAGGUUCAGG CAcg a c G A U au aag
Accession | MIMAT0000742 |
Description | Mus musculus mmu-miR-378a-5p mature miRNA |
Sequence | 5 - CUCCUGACUCCAGGUCCUGUGU - 26 |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0003151 |
Description | Mus musculus mmu-miR-378a-3p mature miRNA |
Sequence | 43 - ACUGGACUUGGAGUCAGAAGG - 63 |
Evidence |
experimental
cloned [2], Illumina [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|