miRBase entry: hsa-mir-18b

Stem-loop hsa-mir-18b


Accession
MI0001518
Symbol
HGNC: MIR18B
Description
Homo sapiens hsa-mir-18b precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR18B is a microRNA that has been implicated in various diseases and biological processes. It is part of a cluster of miRNAs, including miR17, miR20a, miR20b, miR18a, and miR106a, which have been extensively studied in the context of cancer [PMC3544584]. In polycystic ovary syndrome (PCOS), MIR18B has been found to be upregulated in the follicular fluid of PCOS patients compared to normal women [PMC6956659]. Additionally, MIR18B has been reported to repress MDM2 and activate p53 [PMC9791775]. In cutaneous squamous cell carcinoma (CSCC), MIR18B is one of the upregulated miRNAs in CSCC samples [PMC3341860]. Other studies have shown that MIR18B is involved in cell cycle regulation and inflammation-associated conditions [PMC9555085] [PMC7432402]. In breast cancer patients undergoing neoadjuvant therapy (NAT), high expression of MIR18B has been associated with response to treatment [PMC8537499]. Furthermore, dysregulation of MIR18B expression has been proposed as a prognostic marker for mantle cell lymphoma (MCL) and nasopharyngeal carcinoma (NPC) patients [PMC6183594] [PMC6368411]. Additionally, it has been suggested that MIR18B may play a role in the positive regulation of Orai3 expression through its interaction with other microRNAs such as miR18a [PMC9817886].

Literature search
106 open access papers mention hsa-mir-18b
(268 sentences)

Sequence

234541 reads, 1926 reads per million, 99 experiments
uguguUAAGGUGCAUCUAGUGCAGUUAGugaagcagcuuagaaucuacUGCCCUAAAUGCCCCUUCUGGCa
(((...((((.((((.(((.(((((.((................))))))).))).)))).))))...)))

Structure
   guU    U    C   U     U  ugaagca 
ugu   AAGG GCAU UAG GCAGU AG       g
|||   |||| |||| ||| ||||| ||        
aCG   UUCC CGUA AUC CGUca uc       c
   GUC    C    A   C     -  uaagauu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 134170041-134170111 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-18b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-18b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-18b-5p

Accession MIMAT0001412
Description Homo sapiens hsa-miR-18b-5p mature miRNA
Sequence 6 - UAAGGUGCAUCUAGUGCAGUUAG - 28
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-18b-3p

Accession MIMAT0004751
Description Homo sapiens hsa-miR-18b-3p mature miRNA
Sequence 49 - UGCCCUAAAUGCCCCUUCUGGC - 70
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15944709
    c-Myc-regulated microRNAs modulate E2F1 expression
    "O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT"
    "Nature (2005) 435:839-843