MIR18B is a microRNA that has been implicated in various diseases and biological processes. It is part of a cluster of miRNAs, including miR17, miR20a, miR20b, miR18a, and miR106a, which have been extensively studied in the context of cancer [PMC3544584]. In polycystic ovary syndrome (PCOS), MIR18B has been found to be upregulated in the follicular fluid of PCOS patients compared to normal women [PMC6956659]. Additionally, MIR18B has been reported to repress MDM2 and activate p53 [PMC9791775]. In cutaneous squamous cell carcinoma (CSCC), MIR18B is one of the upregulated miRNAs in CSCC samples [PMC3341860]. Other studies have shown that MIR18B is involved in cell cycle regulation and inflammation-associated conditions [PMC9555085] [PMC7432402]. In breast cancer patients undergoing neoadjuvant therapy (NAT), high expression of MIR18B has been associated with response to treatment [PMC8537499]. Furthermore, dysregulation of MIR18B expression has been proposed as a prognostic marker for mantle cell lymphoma (MCL) and nasopharyngeal carcinoma (NPC) patients [PMC6183594] [PMC6368411]. Additionally, it has been suggested that MIR18B may play a role in the positive regulation of Orai3 expression through its interaction with other microRNAs such as miR18a [PMC9817886].
guU U C U U ugaagca ugu AAGG GCAU UAG GCAGU AG g ||| |||| |||| ||| ||||| || aCG UUCC CGUA AUC CGUca uc c GUC C A C - uaagauu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0001412 |
Description | Homo sapiens hsa-miR-18b-5p mature miRNA |
Sequence | 6 - UAAGGUGCAUCUAGUGCAGUUAG - 28 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004751 |
Description | Homo sapiens hsa-miR-18b-3p mature miRNA |
Sequence | 49 - UGCCCUAAAUGCCCCUUCUGGC - 70 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|