miRBase entry: hsa-mir-20b

Stem-loop hsa-mir-20b


Accession
MI0001519
Symbol
HGNC: MIR20B
Description
Homo sapiens hsa-mir-20b precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR20B is a microRNA that is found to have low expression in PC3 GSCs and U87MG GSCs, which are characterized by high glycolytic activity and expression of CD44 and ALDH1A3 mesenchymal markers [PMC7463503]. In TE3 esophageal cancer cells, transfection of MIR20B affected autophagy [PMC5302951]. Overexpression of the miR‐106a‐363 cluster, which includes MIR20B, exhibited an anti-proliferative effect on cancer cells [PMC8410538]. Upregulation of MIR20B reduced metastasis of 4T1 breast cancer cells to the lung, suggesting its role as a tumor suppressor miRNA [PMC7062679]. The rs13897515 polymorphism of the MIR20B gene has been associated with differences in Aβ1-42 levels in the cerebrospinal fluid [PMC9792503]. The ADNI database was queried for SNPs in or near the MIR20B gene on ChrXq26.2 [PMC9054681]. A miRNA peak downstream of MIR20B was highly represented in the testis [PMC3576234]. In a study predicting module genes, MIR106A, MIR106B, MIR20B, and MIR519D were identified as potential miRNAs [PMC9208509]. Individual assays also studied miR15b, MIR20B, miR122, miR-140-3p, miR-185, miR-192, miR-375, miR-483-5p and miR885-5P [PMC3956820]. In relation to Alzheimer's disease (AD), when the APOE ε4 allele was absent, higher levels of MIR20B were associated with reduced probability of AD and increased probability of normal cognitive function [PMC9054681].

Literature search
208 open access papers mention hsa-mir-20b
(659 sentences)

Sequence

12866 reads, 152 reads per million, 136 experiments
aguacCAAAGUGCUCAUAGUGCAGGUAGuuuuggcaugacucuACUGUAGUAUGGGCACUUCCAGuacu
(((((..(((((((((((.(((((..((((.......))))...))))).)))))))))))...)))))

Structure
     -CA           G     -GU    uu 
aguac   AAGUGCUCAUA UGCAG   AGuu  g
|||||   ||||||||||| |||||   ||||  g
ucauG   UUCACGGGUAU AUGUC   ucag  c
     ACC           G     Auc    ua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 134169809-134169877 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-20b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-20b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-20b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-20b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-20b-5p

Accession MIMAT0001413
Description Homo sapiens hsa-miR-20b-5p mature miRNA
Sequence 6 - CAAAGUGCUCAUAGUGCAGGUAG - 28
Evidence experimental
array-cloned [2], cloned [3-5]
Database links
Predicted targets

Mature hsa-miR-20b-3p

Accession MIMAT0004752
Description Homo sapiens hsa-miR-20b-3p mature miRNA
Sequence 44 - ACUGUAGUAUGGGCACUUCCAG - 65
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  5. PubMed ID: 15944709
    c-Myc-regulated microRNAs modulate E2F1 expression
    "O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT"
    "Nature (2005) 435:839-843