Dre-mir-454a is a candidate endogenous reference gene that was investigated for its suitability in a study [PMC8613261]. Normfinder software ranked dre-mir-454a as the third most stable gene among the preselected candidates [PMC8613261]. However, when expression data from MTZ treatments was considered, dre-mir-454a moved to the seventh position in the ranking [PMC8613261]. Additionally, when looking at three different strains, dre-mir-454a ranked fourth among the candidates [PMC8613261]. These rankings indicate that dre-mir-454a may not be as stable as other candidate reference genes in certain experimental conditions. The study aimed to identify suitable endogenous reference genes and investigated a total of nine candidates, including dre-mir-454a, for their suitability [PMC8613261]. The findings suggest that while dre-mir-454a may not be the most stable reference gene in all conditions, it could still be considered as a potential reference gene depending on the specific experimental context. Further research is needed to validate its stability and suitability in different experimental settings.
u c cguuuaagaauuaau uu --- cu gucca u ug aggu ccuaa cuugggacccuau caguauugc cugcu cug g || |||| ||||| ||||||||||||| ||||||||| ||||| ||| ac ucca ggauu ggauuuuGGGAUA GUUAUAACG GAUga gac u g u -----------uguu uu AUC -U ----- u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0001877 |
Description | Danio rerio dre-miR-454a mature miRNA |
Sequence | 77 - UAGUGCAAUAUUGCUAAUAGGG - 98 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
|