MIR432 is a microRNA gene that has been implicated in various biological processes and diseases, including lung adenocarcinoma (LAD) and drug resistance in ovarian cancer [PMC4991437]. In LAD, MIR432 expression is inversely related to the levels of E2F3 and AXL, suggesting a regulatory role in the disease's pathology [PMC4991437]. Additionally, MIR432 expression is significantly reduced in LAD, which may contribute to the alleviation of post-transcriptional gene repression [PMC4077804]. Despite its associations with cancer-related genes and pathways, direct binding of p53 to MIR432 has not been confirmed in neuroblastoma cell lines with wild-type p53 [PMC4356961]. Furthermore, MIR432 has been identified as one of the strongest microRNA genes through various statistical measures such as simP [PMC5144977], and its expression levels differ between sun-exposed and sun-protected skin in young donors compared to old age donors [PMC6113407]. The gene is located within the DLK1-DIO3 genomic region at 14q32, which is known for its complex imprinting and gene regulation mechanisms involving several small nucleolar RNAs (snoRNAs) and microRNAs including MIR431, MIR433, and MIR136 [PMC6202974].
- c U U UA G a u - uu uga cu cuccagg C UGGAG GGUCAUU GGUGG ucc c ua u ||| || ||||||| | ||||| ||||||| ||||| ||| | || acu ga gagguUC G ACCUC UCGGUAG UCacc ggg g au c a u U U -C G - u c uc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002814 |
| Description | Homo sapiens hsa-miR-432-5p mature miRNA |
| Sequence | 14 - UCUUGGAGUAGGUCAUUGGGUGG - 36 |
| Evidence |
experimental
array-cloned [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002815 |
| Description | Homo sapiens hsa-miR-432-3p mature miRNA |
| Sequence | 62 - CUGGAUGGCUCCUCCAUGUCU - 82 |
| Evidence |
experimental
array-cloned [1] |
|