Stem-loop hsa-mir-181d

Accession

MI0003139

Symbol

HGNC: MIR181D

Description

Homo sapiens hsa-mir-181d precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR181D is a microRNA that has been associated with various biological processes and diseases. The rs8108402 C/T polymorphism, located in the promoter region of MIR181D, has been linked to susceptibility to systemic lupus erythematosus in the Chinese population of Guanxi Province [PMC9396029]. Ectopic expression of MIR181D has been shown to suppress tumor cell growth by downregulating MALT1 [PMC6125328]. However, relative quantification revealed no compensatory up-regulation of MIR181D in miR-181a/b-1 knockout thymocytes [PMC4682956]. MIR181D is involved in the regulation of sterol O-acyltransferase 2 (SOAT2), which plays a crucial role in cholesterol conversion [PMC7460638]. Additionally, MIR181D and other miRNAs have been shown to function as transcriptional regulators by binding to DNA promoters [PMC9967498]. In the context of chronic obstructive pulmonary disease (COPD), downregulation of MIR181D and other miRNAs has been observed in lung tissue, while increased expression of miR223 and miR424-5p has been associated with COPD-related muscle wasting [PMC6089098] [PMC6089098] [PMC6089098] . These findings suggest that microRNA-mRNA interactions may play important roles in COPD pathogenesis. Furthermore, next-generation sequencing and bioinformatic analyses have revealed interactions between NEAT1, various pseudogenes, miRNAs (including MIR181D), protein-coding genes, rRNAs, snRNAs, and tRNA within the microenvironment of COPD airways [PMC9730017]. In summary, MIR181D is a microRNA involved in various biological processes and diseases. Its polymorphism has been associated with susceptibility to systemic lupus erythematosus, and its ectopic expression has been shown to suppress tumor cell growth. MIR181D is also involved in the regulation of cholesterol conversion and functions as a transcriptional regulator. In the context of COPD, downregulation of MIR181D and other miRNAs has been observed in lung tissue, while increased expression of certain miRNAs has been associated with muscle wasting. The interactions between MIR181D and other molecules within the COPD airway microenvironment have also been identified.

Literature search

240 open access papers mention hsa-mir-181d
(867 sentences)

Sequence

46085 reads, 306 reads per million, 117 experiments

guccccuccccuaggccacagccgaggucacaaucAACAUUCAUUGUUGUCGGUGGGUugugaggacugaggccagacCCACCGGGGGAUGAAUGUCACuguggcugggccagacacggcuuaaggggaauggggac
(((((((((((((((((...(((..(((((((....(((((((((....((((((((((.((.(........)))))))))))))..)))))))))...))))))).))).......))))).))))))..))))))

Structure

      --      -     ----aca   ga       aucA         GUUG          g  a gac 
gucccc  uccccu aggcc       gcc  ggucaca    ACAUUCAUU    UCGGUGGGUu ug g   u
||||||  |||||| |||||       |||  |||||||    |||||||||    |||||||||| || |    
cagggg  agggga uucgg       cgg  ucggugu    UGUAAGUAG    GGCCACCcag ac c   g
      ua      a     cacagac   -g       -CAC         --GG          -  - gga 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr19: 13874875-13875011 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-181d

Disease association

hsa-mir-181d is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-181d-5p

• Accession: MIMAT0002821
• Description: Homo sapiens hsa-miR-181d-5p mature miRNA
• Sequence: 36 - AACAUUCAUUGUUGUCGGUGGGU - 58
• Evidence: experimental ; array-cloned [1], cloned [2], Illumina [3]

Mature hsa-miR-181d-3p

• Accession: MIMAT0026608
• Description: Homo sapiens hsa-miR-181d-3p mature miRNA
• Sequence: 79 - CCACCGGGGGAUGAAUGUCAC - 99
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45