Stem-loop hsa-mir-527

Accession

MI0003179

Symbol

HGNC: MIR527

Description

Homo sapiens hsa-mir-527 precursor miRNA

Literature search

6 open access papers mention hsa-mir-527
(12 sentences)

Sequence

11 reads, 2 reads per million, 7 experiments

ucucaagcugugaCUGCAAAGGGAAGCCCUUUCuguugucuaaaagaaaagaaagugcuucccuuuggugaauuacgguuugaga
(((((((((((((...(((((((((((.((((((....(((...)))..)))))).))))))))))).....)))))))))))))

Structure

             --CUG           C      guug   a 
ucucaagcuguga     CAAAGGGAAGC CUUUCu    ucu  
|||||||||||||     ||||||||||| ||||||    ||| a
agaguuuggcauu     guuucccuucg gaaaga    aga  
             aagug           u      --aa   a 

Annotation confidence Not enough data

Comments

miR-527 cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context

chr19: 53754018-53754102 [+]

Clustered miRNAs

7 other miRNAs are < 10 kb from hsa-mir-527

Disease association

hsa-mir-527 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-527

• Accession: MIMAT0002862
• Description: Homo sapiens hsa-miR-527 mature miRNA
• Sequence: 14 - CUGCAAAGGGAAGCCCUUUC - 33
• Evidence: experimental ; array-cloned [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770