Stem-loop hsa-mir-487b

Accession

MI0003530

Symbol

HGNC: MIR487B

Description

Homo sapiens hsa-mir-487b precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR487B is a microRNA that belongs to the miR655 miRNA cluster and is expressed in various tissues and diseases. It is one of the miRNAs in the cluster that has available expression data [PMC7465874]. MIR487B has been found to be downregulated in gliomas, but its functional role in glial neoplasms has not been explored [PMC5288128]. In an in vivo model of chronic heart failure, MIR487B was found to inhibit the IL-33/ST2 signaling axis, resulting in improved cardiac morphology and reduced collagen expression [PMC8663982]. MIR487B is also part of the DLK1-MEG3 cluster and has been shown to be significantly reduced or silenced by DNA hypermethylation in bladder tumor tissues and cell lines [PMC4348104]. In multiple sclerosis, MIR487B is less expressed in the diseased context [PMC4655260]. Tobacco smoking-induced epigenetic downregulation of MIR487B leads to overexpression of various polycomb group proteins and stem cell-related genes [PMC6116004]. Chromosome 8 contains an expression quantitative trait locus (eQTL) for MIR487B [PMC4755013]. Additionally, elevated levels of MIR487B have been observed in peripheral blood mononuclear cells of patients with stroke [PMC7123062]. Higher expression levels of MIR487B have also been associated with poor survival outcomes based on data from The Cancer Genome Atlas (TCGA) database [PMC5975595]. A-to-I editing and Nm modifications can alter the targets of tumor suppressor microRNA such as MIR487B, promoting angiogenesis. Increased levels of Ψ writers RPUSD3 and RPUSD4 can induce defective assembly of oxidative phosphorylation system proteins [PMC9916637].

Literature search

31 open access papers mention hsa-mir-487b
(50 sentences)

Sequence

5540 reads, 85 reads per million, 85 experiments

uugguacuuggagaGUGGUUAUCCCUGUCCUGUUCGuuuugcucaugucgAAUCGUACAGGGUCAUCCACUUuuucaguaucaa
.(((((((.(((((((((....((((((.(.(((((............))))).).))))))....))))))))).))))))).

Structure

u       u         UUAU      C U     uuuug 
 ugguacu ggagaGUGG    CCCUGU C GUUCG     c
 ||||||| |||||||||    |||||| | |||||      
 acuauga uuuUUCACC    GGGACA G UAAgc     u
a       c         UACU      U C     uguac 

Annotation confidence Not enough data

Genome context

chr14: 101046455-101046538 [+]

Clustered miRNAs

19 other miRNAs are < 10 kb from hsa-mir-487b

Disease association

hsa-mir-487b is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-487b-3p

• Accession: MIMAT0003180
• Description: Homo sapiens hsa-miR-487b-3p mature miRNA
• Sequence: 51 - AAUCGUACAGGGUCAUCCACUU - 72
• Evidence: experimental ; cloned [1-2], Illumina [3]

Mature hsa-miR-487b-5p

• Accession: MIMAT0026614
• Description: Homo sapiens hsa-miR-487b-5p mature miRNA
• Sequence: 15 - GUGGUUAUCCCUGUCCUGUUCG - 36
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45