miRBase entry: hsa-mir-598

Stem-loop hsa-mir-598


Accession
MI0003610
Symbol
HGNC: MIR598
Description
Homo sapiens hsa-mir-598 precursor miRNA mir-598
Gene
family?
RF01059; mir-598

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR598 is a microRNA gene that has been closely examined in the context of 8p23.1 duplication syndrome. Through SNP array analysis, it was found that MIR598 is located in the core duplicated interval of this syndrome, along with other dosage sensitive genes such as SOX7, TNKS1, MIR124-1 [PMC7947009]. MIR598 has been implicated in various aspects of colorectal cancer (CRC). It has been shown to inhibit metastasis in CRC by suppressing the JAG1-Notch2 pathway and stimulating epithelial-mesenchymal transition [PMC6287550]. Additionally, MIR598 plays a negative role by regulating cMyc, K-Ras, and KLF4 [PMC7602903]. It also suppresses epithelial-mesenchymal transition by inhibiting the Notch pathway [PMC7602903]. However, it is worth noting that there is some uncertainty regarding the classification of MIR598 as a microRNA gene. While it was initially predicted to be a miRNA gene [PMC3667022]'>PMC3667022], subsequent analysis did not include the sequence of mature miRNA MIR598 and thus it has been reclassified as an unknown messenger-like non-coding RNA [PMC3667022]. Overall, MIR598 appears to have potential implications in neuropsychiatric disorders such as autism spectrum disorder and compromised neurocognition in 8p23.1 duplication syndrome patients [PMC7947009] [PMC4268894].

Literature search
14 open access papers mention hsa-mir-598
(27 sentences)

Sequence

190577 reads, 393 reads per million, 107 experiments
gcuugaugaugcugcugaugcugGCGGUGAUCCCGAUGGUGUGAGCuggaaauggggugcUACGUCAUCGUUGUCAUCGUCAucaucaucauccgag
.((((((((......(((((.((((((((((..((((((((((.(((........)))..))))))))))..)))))))))).))))))))).))))

Structure
g    -    ugcugc     c          CC          -A   gga 
 cuug auga      ugaug ugGCGGUGAU  CGAUGGUGUG  GCu   a
 |||| ||||      ||||| ||||||||||  ||||||||||  |||    
 gagc uacu      acuac ACUGCUACUG  GCUACUGCAU  ugg   a
-    c    ------     u          UU          cg   ggu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr8: 11035206-11035302 [-]

Disease association
hsa-mir-598 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-598-3p

Accession MIMAT0003266
Description Homo sapiens hsa-miR-598-3p mature miRNA
Sequence 61 - UACGUCAUCGUUGUCAUCGUCA - 82
Evidence experimental
Microarray [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-598-5p

Accession MIMAT0026620
Description Homo sapiens hsa-miR-598-5p mature miRNA
Sequence 24 - GCGGUGAUCCCGAUGGUGUGAGC - 46
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45