Stem-loop hsa-mir-671

Accession

MI0003760

Symbol

HGNC: MIR671

Description

Homo sapiens hsa-mir-671 precursor miRNA mir-671

Gene
family

RF00891; mir-671

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR671 is a microRNA that has been identified in various studies and has been found to play a role in different biological processes. In one study, six miRNAs, including MIR671, were identified, but only miR1226 showed statistically significant differences [PMC6764711]. Another study found that MIR671 is present in EpCAM-Exos and is one of eight novel miRNAs identified [PMC5137021]. Multiple studies have shown that MIR671, along with other genes such as Lcn2, Cd74, and Cebpd, play a role in the immune response of macrophages and/or microglia as retinal degeneration increases [PMC8362665] [PMC4872275]. Additionally, MIR671 has been found to be involved in regulating extracellular matrix production and acts as a sponge for its target transcript [PMC4872275] [PMC9918958]. In the context of preeclampsia, MIR671 was found to be increased along with other miRNAs associated with various processes such as injury, oxidative stress, inflammation, and hypertension [PMC5933288]. Furthermore, MIR671 was identified as one of the upregulated intragenic miRNAs residing within upregulated genes in non-protein coding regions [PMC5823624]. These findings highlight the diverse roles of MIR671 in different biological contexts.

Literature search

40 open access papers mention hsa-mir-671
(291 sentences)

Sequence

23353 reads, 373 reads per million, 141 experiments

gcaggugaacuggcaggccaggaagaggAGGAAGCCCUGGAGGGGCUGGAGgugauggauguuuuccUCCGGUUCUCAGGGCUCCACCucuuucgggccguagagccagggcuggugc
(((...(..(((((.((((.((((((((.(((.((((((..(((((((((((.((.......)).)))))))))))))))))))).)))))))).)))).....)))))..)...)))

Structure

   ggu aa     ----a    a        A   A      GA           u  ug 
gca   g  cuggc     ggcc ggaagagg GGA GCCCUG  GGGGCUGGAGg ga  g
|||   |  |||||     |||| |||||||| ||| ||||||  ||||||||||| ||  a
cgu   c  gaccg     ccgg cuuucuCC CCU CGGGAC  UCUUGGCCUcc uu  u
   ggu gg     agaug    g        A   -      --           u  ug 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr7: 151238421-151238538 [+]

Disease association

hsa-mir-671 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-671-5p

• Accession: MIMAT0003880
• Description: Homo sapiens hsa-miR-671-5p mature miRNA
• Sequence: 29 - AGGAAGCCCUGGAGGGGCUGGAG - 51
• Evidence: experimental ; cloned [1-2]

Mature hsa-miR-671-3p

• Accession: MIMAT0004819
• Description: Homo sapiens hsa-miR-671-3p mature miRNA
• Sequence: 68 - UCCGGUUCUCAGGGCUCCACC - 88
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298