miRBase entry: hsa-mir-889

Stem-loop hsa-mir-889


Accession
MI0005540
Symbol
HGNC: MIR889
Description
Homo sapiens hsa-mir-889 precursor miRNA mir-889
Gene
family?
RF04293; mir-889

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR889 is a miRNA that belongs to the miR655 miRNA cluster, which contains a total of 20 miRNAs [PMC7465874]. Nine of these miRNAs, including MIR889, have available expression data [PMC7465874]. In the context of HCV and chronic HCV complications, several upregulated miRNAs have been identified, including MIR889 [PMC9495750]. The expression data for the miR655 cluster reveals that it contains 16 miRNAs [PMC10148110]. Cancer cells have mechanisms to evade immune surveillance and tumor cell-derived extracellular vesicles (EVs) play a role in transmitting immune-suppressive messages in the tumor microenvironment [PMC10114864]. EV-incorporated RNAs can help cancer cells evade immune responses and convey death signals to immune cells [PMC10114864]. In colorectal cancer, EV-miR203 is involved in cellular immunosuppression by activating M2-tumor-associated macrophages [PMC10114864]. Additionally, MIR889 triggers the downregulation of immune infiltration in colorectal cancer [PMC10114864]. In a study on dogs, several highly differentially expressed (DE) miRNAs were identified, including MIR889 [PMC8376273]. Overall, MIR889 is a member of the miR655 cluster and has been implicated in various aspects of cancer biology and immunosuppression.

Literature search
10 open access papers mention hsa-mir-889
(21 sentences)

Sequence

6883 reads, 80 reads per million, 77 experiments
gugcuuaaagAAUGGCUGUCCGUAGUAUGGUCucuauauuuaugaugaUUAAUAUCGGACAACCAUUGUuuuaguaucc
(((((.(((.(((((.((((((..((.(((((((.........)).)))))))..)))))).))))).))).)))))..

Structure
--     u   g     C      UA  A     -  uau 
  gugcu aaa AAUGG UGUCCG  GU UGGUC uc   a
  ||||| ||| ||||| ||||||  || ||||| ||   u
  uauga uuU UUACC ACAGGC  UA AUUag ag   u
cc     u   G     A      UA  -     u  uau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101047901-101047979 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-889
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-889 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-889-3p

Accession MIMAT0004921
Description Homo sapiens hsa-miR-889-3p mature miRNA
Sequence 49 - UUAAUAUCGGACAACCAUUGU - 69
Evidence experimental
cloned [1], Illumina [2]
Database links
Predicted targets

Mature hsa-miR-889-5p

Accession MIMAT0026719
Description Homo sapiens hsa-miR-889-5p mature miRNA
Sequence 11 - AAUGGCUGUCCGUAGUAUGGUC - 32
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45