Hsa-mir-147b is a microRNA that has been found to be associated with rectum cancer [29]. In the presence of the CHRM3 gene, bile acid is likely to induce right-sided colon tumors and decrease the expression of hsa-mir-147b [PMC10152154]. Several effective pairings of microRNAs have been identified in different countries, including hsa-mir-1267, hsa-mir-325, hsa-mir-5683, and hsa-mir-3064-5p in China; hsa-mir-5197, hsa-mir-147b, hsa-mir-6874, hsa-mir-138-1, hsa-mir-664b, and hsa-mir1-3p in India; and hasmir1267, hasmir1381, hasmir664b and hasmir13p in Italy [PMC7395633]. These microRNA pairings have been found to have interactions with viral SARS-CoV2 miRNAs [PMC7395633]. In Jamaica specifically, there are three collective pairings of microRNAs involved with viral SARS-CoV2 miRNAs: hasmir1267, hasmir325 and hasmir5683 [PMC7395633]. These findings suggest that different microRNA pairings may play a role in cancer development and viral interactions in different populations. Further research is needed to understand the specific mechanisms involved.
-- u c A AACUagauu a ua aaau uagUGGAA CAUUUCUGCACA cugg || |||| |||||||| |||||||||||| |||| c au uuua aUCGUCUU GUAAAGGCGUGU Gacc gg u c C --------- a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004928 |
Description | Homo sapiens hsa-miR-147b-3p mature miRNA |
Sequence | 49 - GUGUGCGGAAAUGCUUCUGCU - 69 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0037331 |
Description | Homo sapiens hsa-miR-147b-5p mature miRNA |
Sequence | 12 - UGGAAACAUUUCUGCACAAACU - 33 |
Evidence | not_experimental |
|