miRBase entry: hsa-mir-190b

Stem-loop hsa-mir-190b


Accession
MI0005545
Symbol
HGNC: MIR190B
Description
Homo sapiens hsa-mir-190b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-190b, an miRNA, was found to be upregulated and involved in the regulation of FGF2 downregulation, which in turn alleviated the inflammatory response and vascular endothelial injury [PMC8923688]. Additionally, hsa-mir-190b was found to activate the expression of FGF2 and FGFR1 proteins [PMC8923688]. On the other hand, hsa-mir-190b and hsa-miR-449a were identified as the most significantly downregulated miRNAs [PMC7499949].

The upregulation of hsa-mir-190b suggests its potential role in modulating FGF2 expression [PMC8923688]. This regulation of FGF2 may contribute to the alleviation of inflammatory response and vascular endothelial injury [PMC8923688'>PMC8923688'>PMC8923688'>PMC8923688]. The activation of FGF2 and FGFR1 protein expression by hsa-mir-190b further supports its involvement in cellular processes [PMC8923688].

In contrast to its upregulation, hsa-mir-190b was found to be downregulated along with hsa-miR-449a [PMC7499949]. This downregulation suggests a potential role for these miRNAs in different cellular processes or pathways [PMC7499949].

In summary, hsa-mir-190b is an miRNA that is upregulated and involved in regulating FGF2 expression [PMC8923688]. This regulation may contribute to alleviating inflammatory response and vascular endothelial injury while activating FGF2 and FGFR1 protein expression [PMC8923688]. Additionally, both hsa-mir-190b and hsa-miR-449a were significantly downregulated [PMC7499949] [PMC8923688].

Literature search
49 open access papers mention hsa-mir-190b
(225 sentences)

Sequence

3141 reads, 65 reads per million, 66 experiments
ugcuucugugUGAUAUGUUUGAUAUUGGGUUGuuuaauuaggaaccaACUAAAUGUCAAACAUAUUCUuacagcagcag
((((.(((((.(((((((((((((((.((((((((......))).))))).)))))))))))))))..))))).)))).

Structure
-    u     -U               G     -   aa 
 ugcu cugug  GAUAUGUUUGAUAUU GGUUG uuu  u
 |||| |||||  ||||||||||||||| ||||| |||   
 acga gacau  UUAUACAAACUGUAA UCAac aag  u
g    c     UC               A     c   ga 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 154193665-154193743 [-]

Disease association
hsa-mir-190b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-190b-5p

Accession MIMAT0004929
Description Homo sapiens hsa-miR-190b-5p mature miRNA
Sequence 11 - UGAUAUGUUUGAUAUUGGGUUG - 32
Evidence not_experimental
Database links
Predicted targets

Mature hsa-miR-190b-3p

Accession MIMAT0037332
Description Homo sapiens hsa-miR-190b-3p mature miRNA
Sequence 48 - ACUAAAUGUCAAACAUAUUCU - 68
Evidence not_experimental

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414