Stem-loop hsa-mir-873

Accession

MI0005564

Symbol

HGNC: MIR873

Description

Homo sapiens hsa-mir-873 precursor miRNA mir-873

Gene
family

RF00910; mir-873

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR873 is a microRNA molecule that plays a role in various biological processes, including cancer development and drug resistance [PMC7589921]. It has been found to be upregulated in thyroid cancer, suggesting its involvement in the disease [PMC4621222]. Additionally, MIR873 has been identified as a potential biomarker for the diagnosis of different cancers, such as lung cancer and breast cancer [PMC4621222]. In the context of musculoskeletal disease, MIR873 has been associated with bone geometry and muscle metabolism [PMC3210160]. It is located within a genomic region that also contains the MIR876 gene, and both genes have been strongly associated with bone geometry and muscle mass in Chinese populations [PMC3210160]. However, these associations were not replicated in Caucasians [PMC3210160]. MIR873 has also been implicated in neural diseases based on its target genes associated with such diseases [PMC7708977]. In pregnancy-related conditions, circulating levels of MIR873 have been found to be negatively associated with insulin sensitivity [PMC8900031]. Overall, these findings highlight the diverse roles of MIR873 in various biological processes and its potential as a diagnostic biomarker for different diseases.

Literature search

19 open access papers mention hsa-mir-873
(34 sentences)

Sequence

4221 reads, 152 reads per million, 76 experiments

gugugcauuuGCAGGAACUUGUGAGUCUCCUauugaaaaugaacaGGAGACUGAUGAGUUCCCGGGAacacccacaa
(((.(..(((.(.(((((((((.((((((((.((.......)).)))))))).))))))))).).)))..).)))..

Structure

--   u ca   G A         G        a  ga 
  gug g  uuu C GGAACUUGU AGUCUCCU uu  a
  ||| |  ||| | ||||||||| |||||||| ||  a
  cac c  aAG G CCUUGAGUA UCAGAGGa aa  a
aa   c ac   G C         G        c  gu 

Annotation confidence High

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr9: 28888879-28888955 [-]

Disease association

hsa-mir-873 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-873-5p

• Accession: MIMAT0004953
• Description: Homo sapiens hsa-miR-873-5p mature miRNA
• Sequence: 11 - GCAGGAACUUGUGAGUCUCCU - 31
• Evidence: experimental ; cloned [2]

Mature hsa-miR-873-3p

• Accession: MIMAT0022717
• Description: Homo sapiens hsa-miR-873-3p mature miRNA
• Sequence: 46 - GGAGACUGAUGAGUUCCCGGGA - 67
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298