WARNING: This summary was generated by AI. MIR1179 is a microRNA implicated in the regulation of thyroid-stimulating hormone (TSH), with a notable association signal identified in genetic studies (P = 2.89×10−10) [PMC3567175]. Although it is not highly represented in the thyroid, it is one of several novel loci that have been linked to TSH regulation, suggesting a potential role in thyroid function [PMC3567175]. The TSH-elevating allele at the MIR1179 locus also appears to be correlated with decreasing levels of free thyroxine (FT4), indicating a possible influence on thyroid hormone synthesis or secretion [PMC3567175]. The biological relevance of MIR1179 has been further highlighted by experiments showing that biotin-labeled hsa-miR-1179 probes can enrich specific mRNA targets, suggesting that MIR1179 may have functional interactions with other genes or transcripts [PMC8716807]. Additionally, MIR1179 expression has been found to be up-regulated in non-functioning adenomas due to lower methylation rates, which may contribute to the pathophysiology of these adenomas [PMC7652879]. However, further research is necessary to confirm these findings and elucidate the precise biological mechanisms by which MIR1179 influences TSH levels and thyroid function [PMC3567175]. Biological targets for MIR1179 have been validated using bioinformatics tools such as TargetScan, providing a foundation for future studies on its role and interactions within cellular pathways [PMC8572446].
----- a -- C ugu ua
ggcugg aaagga gAA GCAUUCUUU AUUGGUUGG g u
|||||| |||||| ||| ||||||||| ||||||||| |
ucgauc uuuccu uuu cguaggaga uaaccaacu c u
agucu a ac a guu cg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005824 |
| Description | Homo sapiens hsa-miR-1179-5p mature miRNA |
| Sequence | 15 - AAGCAUUCUUUCAUUGGUUGG - 35 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|