miRBase entry: hsa-mir-1179

Stem-loop hsa-mir-1179


Accession
MI0006272
Symbol
HGNC: MIR1179
Description
Homo sapiens hsa-mir-1179 precursor miRNA mir-1179
Gene
family?
RF03469; mir-1179

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR1179 is a microRNA implicated in the regulation of thyroid-stimulating hormone (TSH), with a notable association signal identified in genetic studies (P = 2.89×10−10) [PMC3567175]. Although it is not highly represented in the thyroid, it is one of several novel loci that have been linked to TSH regulation, suggesting a potential role in thyroid function [PMC3567175]. The TSH-elevating allele at the MIR1179 locus also appears to be correlated with decreasing levels of free thyroxine (FT4), indicating a possible influence on thyroid hormone synthesis or secretion [PMC3567175]. The biological relevance of MIR1179 has been further highlighted by experiments showing that biotin-labeled hsa-miR-1179 probes can enrich specific mRNA targets, suggesting that MIR1179 may have functional interactions with other genes or transcripts [PMC8716807]. Additionally, MIR1179 expression has been found to be up-regulated in non-functioning adenomas due to lower methylation rates, which may contribute to the pathophysiology of these adenomas [PMC7652879]. However, further research is necessary to confirm these findings and elucidate the precise biological mechanisms by which MIR1179 influences TSH levels and thyroid function [PMC3567175]. Biological targets for MIR1179 have been validated using bioinformatics tools such as TargetScan, providing a foundation for future studies on its role and interactions within cellular pathways [PMC8572446].

Literature search
3 open access papers mention hsa-mir-1179
(5 sentences)

Sequence

736 reads, 5 reads per million, 59 experiments
ggcuggaaaggaagAAGCAUUCUUUCAUUGGUUGGuguguauugccuugucaaccaauaagaggaugccauuuauccuuuucugacuagcu
((((((((((((.((((((((((((.(((((((((...(......)...))))))))).)))))))))..))).)))))).....))))))

Structure
      -----      a   --         C         ugu ua 
ggcugg     aaagga gAA  GCAUUCUUU AUUGGUUGG   g  u
||||||     |||||| |||  ||||||||| |||||||||   |   
ucgauc     uuuccu uuu  cguaggaga uaaccaacu   c  u
      agucu      a   ac         a         guu cg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 88608107-88608197 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-1179
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-1179 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1179

Accession MIMAT0005824
Description Homo sapiens hsa-miR-1179 mature miRNA
Sequence 15 - AAGCAUUCUUUCAUUGGUUGG - 35
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17922033
    MicroRNA expression signature of human sarcomas
    "Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M"
    "Oncogene (2008) 27:2015-2026