miRBase entry: hsa-mir-3180-1

Stem-loop hsa-mir-3180-1


Accession
MI0014214
Symbol
HGNC: MIR3180-1
Description
Homo sapiens hsa-mir-3180-1 precursor miRNA mir-3180
Gene
family?
RF02010; mir-3180

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3180-3 is a type of microRNA that is disrupted in an individual from Tibet, along with other microRNAs (mir517b, mir517a, mir517c) and their target genes (CD44, FAM115A) [PMC3938728]. In Alzheimer's disease (AD), differentially expressed long non-coding RNAs (lncRNAs) target protein-coding genes (PCGs) involved in AD- and aging-related biological functions [PMC7047416]. Specifically, MIR3180-3 and MIR3180-2 target PCGs involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs that are known to be AD-related [PMC7047416]. These findings suggest that MIR3180-3 may play a role in the pathogenesis of AD. In breast cancer, MIR3180-3 is identified as one of the miRNAs present in multiple breast cancer cell lines but absent in normal-like cell lines [PMC8261273]. In luminal-A breast cancer subtype, MIR3180-3 targets multiple genes including A4GALT, C10orf55, C2orf74, ZC4H2, ZNF512, ZNF655, ZNF71 HCG2042738 and HRCT1 [PMC8261273]. Furthermore, MIR3180-3 is observed in both luminal-A and triple-negative breast cancer subtypes [PMC8261273].

Literature search
7 open access papers mention hsa-mir-3180-1
(61 sentences)

Sequence

4453 reads, 123 reads per million, 63 experiments
cagugcgacgggcggagCUUCCAGACGCUCCGCCCCACGUCGcaugcgccccgggaaagcgUGGGGCGGAGCUUCCGGAGGCCccgcccugcug
....(((..((((((.((((((.((.((((((((((((((....(.((...)).)...)))))))))))))).)).)))))).)))))))))..

Structure
cagu   ac      a      A  C              CGca g  c 
    gcg  gggcgg gCUUCC GA GCUCCGCCCCACGU    u cg  
    |||  |||||| |||||| || ||||||||||||||    | || c
    cgu  cccgcc CGGAGG CU CGAGGCGGGGUgcg    g gc  
--gu   --      C      C  U              -aaa g  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 14911220-14911313 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-3180-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3180-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3180-5p

Accession MIMAT0015057
Description Homo sapiens hsa-miR-3180-5p mature miRNA
Sequence 18 - CUUCCAGACGCUCCGCCCCACGUCG - 42
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-3180-3p

Accession MIMAT0015058
Description Homo sapiens hsa-miR-3180-3p mature miRNA
Sequence 62 - UGGGGCGGAGCUUCCGGAGGCC - 83
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637

  3. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86