MIR3180-2 is a long non-coding RNA (lncRNA) that is highly co-expressed with known Alzheimer's disease (AD)-related genes, such as S100B, AGT, and NTS [PMC7047416]. It has been found that MIR3180-2 and MIR3180-3 target protein-coding genes (PCGs) involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs with known AD-related PCGs, including VTI1A, CUX1, S100B, AGT, NTS, and IRAK4 [PMC7047416]. These findings suggest that MIR3180-2 may play a role in AD pathogenesis. Furthermore, MIR3180-2 is one of the top downregulated lncRNAs in AD [PMC7388310]. Co-expression network analysis has shown that MIR3180-2 is frequently co-expressed with relevant AD risk protein-coding genes [PMC8774680]. It's worth noting that disruptions in mir3180-1, MIR3180-2, and mir3180-3 have been observed along with their target genes CD44 and FAM115A in an individual from Tibet [PMC3938728]. These findings suggest that MIR31802 may have potential as a biomarker for AD.
ac a A C CGca g c gcg gggcgg gCUUCC GA GCUCCGCCCCACGU u cg ||| |||||| |||||| || |||||||||||||| | || c cgu cccgcc CGGAGG CU CGAGGCGGGGUgcg g gc -- C C U -aaa g c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015057 |
Description | Homo sapiens hsa-miR-3180-5p mature miRNA |
Sequence | 14 - CUUCCAGACGCUCCGCCCCACGUCG - 38 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0015058 |
Description | Homo sapiens hsa-miR-3180-3p mature miRNA |
Sequence | 58 - UGGGGCGGAGCUUCCGGAGGCC - 79 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|