MIR378C is a microRNA that has been implicated in various biological processes and diseases, including sepsis and cancer [PMC8358855; PMC8017737].'>PMC8017737].. In sepsis, MIR378C is among the plasma miRNAs that are significantly elevated in patients with community-acquired pneumonia (CAP), suggesting its potential role in the host response to infection [PMC8358855]. In the context of cancer, particularly gastric cancer, MIR378C expression is low, which has been associated with its potential as a diagnostic and prognostic biomarker [PMC8017737]. Notably, MIR378C has been identified as an independent prognostic factor for gastric cancer patients when considering differentiation and TNM staging [PMC8017737]. This finding underscores the significance of MIR378C in clinical outcomes and its potential utility in patient prognosis [PMC8017737].
g ca GAC AGAG gg gaggc ucACUG UUGGAGUCAGA UGGaguc g ||||| |||||| ||||||||||| ||||||| cuccg aguggu aguuucagucu acuucag u - ug gga --ca ac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0016847 |
| Description | Homo sapiens hsa-miR-378c mature miRNA |
| Sequence | 11 - ACUGGACUUGGAGUCAGAAGAGUGG - 35 |
| Evidence |
experimental
SOLiD [1] |
| Database links |
|
| Predicted targets |
|
|