MIR4647 is a non-coding RNA that is located within the 3'-UTR of the SLC35B2 gene [PMC9296583]. It is one of the eight upregulated miRNA sequences found in non-protein coding genes [PMC5823624]. The effects of MIR4647 on cell migration and colony forming were analyzed by optimizing the transfection process of corresponding miRNA precursors [PMC9843305]. The perturbation of MIR4647 by a miRNA inhibitor did not suppress the cytopathic effects of HSV-1 infection [PMC9296583'>PMC9296583]. The genomic locus of MIR4647 overlaps with the 3'-UTR of SLC35B2, suggesting that sgRNAs targeting MIR4647 may reduce the expression of SLC35B2 [PMC9296583]. In a screen, MIR4647 was identified as a candidate miRNA, along with three candidate genes (IRF2BPL, PAPSS1, and VANGL2) [PMC9296583]. Overall, MIR4647 is an intragenic miRNA residing within an upregulated gene and its role in cell migration and colony forming has been investigated [PMC5823624'>PMC5823624] [PMC9843305'>PMC9843305] [PMC9296583]. References: - PMC5823624 - PMC9843305 - PMC5069896 - PMC9296583
g -A A CU A AA gau ccaggag guG AG UGGUG GUGCUG GG aggg g ||||||| ||| || ||||| |||||| || |||| c gguccuc uau uc accac cacgac cc uccc a g cc c -- - -g gag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0019709 |
Description | Homo sapiens hsa-miR-4647 mature miRNA |
Sequence | 11 - GAAGAUGGUGCUGUGCUGAGGAA - 33 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|