miRBase entry: rno-mir-29b-3

Stem-loop rno-mir-29b-3


Accession
MI0031777
Description
Rattus norvegicus rno-mir-29b-3 precursor miRNA

Literature search
121 open access papers mention rno-mir-29b-3
(1125 sentences)

Sequence

108116 reads, 138 reads per million, 481 experiments
cuucuggaagCUGGUUUCACAUGGUGGCUUAGauuuuuccaucuuuguaucUAGCACCAUUUGAAAUCAGUGUUuuaggag
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))

Structure
         -          C      G  U    uuuucc 
cuucuggaa gCUGGUUUCA AUGGUG CU AGau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuUU UGACUAAAGU UACCAC GA Ucua      u
         G          U      -  -    uguuuc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr13: 113782057-113782137 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-29b-3
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-29b-5p

Accession MIMAT0004717
Description Rattus norvegicus rno-miR-29b-5p mature miRNA
Sequence 11 - CUGGUUUCACAUGGUGGCUUAG - 32
Evidence experimental
cloned [3], SOLiD [5]

Mature rno-miR-29b-3p

Accession MIMAT0000801
Description Rattus norvegicus rno-miR-29b-3p mature miRNA
Sequence 52 - UAGCACCAUUUGAAAUCAGUGUU - 74
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714