I've discovered some new miRNA genes. What should I call them?
That is precisely what this service is for! In order to avoid conflicts with previously named miRNAs and in press publications, you should submit your miRNA sequences to the miRBase Registry and we will discuss appropriate names with you.
When should I submit my sequences to you?
To avoid mis-assignment of names we ask that you submit your sequences to us AFTER you have had a manuscript describing the discovery accepted for publication. For an initial submission of a manuscript you should assign temporary names and make it clear to the editor that final names will be assigned on acceptance.
Prior to manuscript submission and acceptance you may be able to find overlaps with previously identified genes for possible discussion in your manuscript by searching the online database.
How should I submit my sequences to you?
Use the submission page. We will contact you by email to discuss the naming of your miRNAs.
But I already know what my sequences should be called!
Please feel free to provide any information about your suggested names in the "other information" section of the submission form. Such information may significantly improve our response times. It is important that final names are assigned through the Registry to ensure that distinct miRNA genes and products are not given the same name. In many cases name assignment will be the result of discussion and agreement between the Registry and the submitter.
Will my sequences be available in the searchable database?
Sequences submitted to us will be added to the miRBase Sequence Database. Please note that this database is not a replacement for the service provided by the international DDBJ/EMBL/GenBank nucleotide databases. To submit your miRNA sequences for inclusion in the DDBJ/EMBL/GenBank data repository, please use the EBI's submission system at http://www.ebi.ac.uk/embl/Submission/webin.html.
In what format do you want my sequences?
Please upload plain text fasta format files NOT Microsoft Word files or other binary formats.
Where possible we would like to include the predicted hairpin precursor sequences in the miRNA database as these enable more advanced analyses than the mature sequences alone. The hairpin precursor sequences also give us more information on relationships between miRNAs and so may impact on our naming suggestions. We therefore need your submitted file to contain the precursor and mature sequences. We can recognise a number of ways of encoding this information:
e.g. mature miR sequence is represented by bases 10-31 of precursor sequence myseq1.- Fasta header describes location of mature sequence
>myseq1 mature:10-31 GAGAGCCGACUGAAACUGAAGAGAGCAGUCUAUUGACAGUCGGUUACUCGAAAUCUUUAC UGUCAUGGAGGCGCUCUCUUCAGAUGAUGUCUGGCCC
>myseq1 GAGAGCCGAcugaaacugaagagagcagucuAUUGACAGUCGGUUACUCGAAAUCUUUAC UGUCAUGGAGGCGCUCUCUUCAGAUGAUGUCUGGCCC
>myseq1-precursor GAGAGCCGACUGAAACUGAAGAGAGCAGUCUAUUGACAGUCGGUUACUCGAAAUCUUUAC UGUCAUGGAGGCGCUCUCUUCAGAUGAUGUCUGGCCC >myseq1-mature CUGAAACUGAAGAGAGCAGUCU
The names of your submitted sequences are unimportant, but it is important that each sequence in your file has a unique single word name. For example:
>myseq1 UCACCGGGUGUACAUCAGCUAA >myseq2 UCACCGGGUGAAAAAUCACCUA >myseq3 UGAGAUCGUUCAGUACGGCA
is fine, but
>myseq 1 UCACCGGGUGUACAUCAGCUAA >myseq 2 UCACCGGGUGAAAAAUCACCUA >myseq 3 UGAGAUCGUUCAGUACGGCA
is not. In the latter case all 3 sequences get the name "myseq", with the numbers interpreted as free text descriptions.
But I don't want my sequences to be available before my manuscript in published!
The service offered by the miRBase Registry is confidential. We will not discuss the contents of your submission with other researchers, and we will not publish your submitted sequences and data prior to publication of your manuscript. However, when researchers submit sequences for naming we need to be able to give them the next available name. This may implicitly give information about papers in press. Submission of data to us constitutes your agreement to this disclosure. Please feel free to contact us if you have any questions about this service.
We ask that you inform us on publication of your manuscript so we can make your sequences available in the online database.
What do the assigned names mean?
The numbering of miRNA genes is simply sequential. For instance at the time of writing the last published miRNA was Arabidopsis MIR171. The next novel published miRNA will get the number 172. However, if you submit an Xenopus miRNA that is identical to human mir-121 for example, we will suggest the name xla-mir-121.
The names in the database are of the form hsa-mir-121b. The first three letters signify the organism. The mir/miR part of the name denote the precursor and the mature sequence respectively. Identical mature sequences from distinct precursors will get names of the form hsa-miR-121-1 and hsa-miR-121-2, while highly similar sequences will have the form hsa-miR-121a and hsa-miR-121b. Finally, different organisms have slightly different naming conventions. For example, in plants published names are of the form MIR121. We try wherever possible to stick to these conventions.
You don't have my already published miRNA sequence
Please use the submission form and indicate that your manuscript is already published.
I still don't understand what I have to do!
Please feel free to mail mirbase@manchester.ac.uk with any queries you have about the naming service.