Accession | MIMAT0000103 |
Description | hsa-miR-106a-5p mature miRNA |
Hairpins | |
Sequence | AAAAGUGCUUACAGUGCAGGUAG |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P49715 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:Q13950 |
acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
acts_upstream_of | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19307576 | occurs_in CL:0000236 |
acts_upstream_of | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19307576 | occurs_in CL:0000084 |
acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26265888 | occurs_in CL:2000001 |
acts_upstream_of_or_within | GO:0045600 positive regulation of fat cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | occurs_in CL:0002570 |
acts_upstream_of_or_within | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | occurs_in CL:0002570 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18684319 | has_input UniProtKB:P05067 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26265888 | has_input UniProtKB:P10145 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18684319 | has_input UniProtKB:P05067 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19307576 | has_input UniProtKB:P22301 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20190813 | has_input UniProtKB:P38936 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22912877 | has_input UniProtKB:P37173 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23562609 | has_input UniProtKB:P78324 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27325313 | has_input UniProtKB:P40763 |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22912877 | has_input UniProtKB:P37173 |
involved_in | GO:0032682 negative regulation of chemokine production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
involved_in | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19307576 | occurs_in CL:0000236 |
involved_in | GO:0032693 negative regulation of interleukin-10 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19307576 | occurs_in CL:0000084 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19307576 | has_input UniProtKB:P22301 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|