Accession | MIMAT0000153 |
Description | mmu-miR-141-3p mature miRNA |
Hairpins | |
Sequence | UAACACUGUCUGGUAAAGAUGG |
Evidence |
experimental
cloned [1,3-4], Illumina [5-6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26371161 | occurs_in UBERON:0001969 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26371161 | occurs_in UBERON:0002349 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26371161 | occurs_in UBERON:0002349 |