Accession | MIMAT0000225 |
Description | mmu-miR-195a-5p mature miRNA |
Hairpins | |
Sequence | UAGCAGCACAGAAAUAUUGGC |
Evidence |
experimental
cloned [1-3], Illumina [4,6] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25903991 | has_input UniProtKB:Q80TS5 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21778430 | has_input UniProtKB:O35280 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25201911 | has_input UniProtKB:P54320 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25903991 | has_input UniProtKB:Q80TS5 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26390028 | has_input UniProtKB:O70372 |
involved_in | GO:0002931 response to ischemia |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30497184 | occurs_in UBERON:0000955 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0010715 regulation of extracellular matrix disassembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25201911 | |
involved_in | GO:0032211 negative regulation of telomere maintenance via telomerase |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:30497184 | occurs_in UBERON:0000955 |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:30497184 | occurs_in UBERON:0000955 |
involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:30497184 | occurs_in UBERON:0000955 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21778430 | has_input UniProtKB:O35280 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25201911 | has_input UniProtKB:P54320 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25903991 | has_input UniProtKB:Q80TS5 |
involved_in | GO:0043065 positive regulation of apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | occurs_in CL:2000079 |
involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25903991 | occurs_in CL:0002334 |
involved_in | GO:0045930 negative regulation of mitotic cell cycle |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21778430 | occurs_in CL:0000746 |
involved_in | GO:0045930 negative regulation of mitotic cell cycle |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21778430 | occurs_in CL:0000746 |
involved_in | GO:0150079 negative regulation of neuroinflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:30497184 | |
involved_in | GO:1902461 negative regulation of mesenchymal stem cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26390028 | results_in_division_of CL:2000079 |