Accession | MIMAT0000392 |
Description | dme-miR-9c-5p mature miRNA |
Hairpins | |
Sequence | UCUUUGGUAUUCUAGCUGUAGA |
Evidence |
experimental
cloned [1], 454 [3-4], Illumina [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:34074704 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17714701 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:34074704 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17714701 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:34074704 | |
involved_in | GO:2000773 negative regulation of cellular senescence |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:34074704 |