Accession | MIMAT0000672 |
Description | mmu-miR-199b-5p mature miRNA |
Hairpins | |
Sequence | CCCAGUGUUUAGACUACCUGUUC |
Evidence |
experimental
cloned [3], Illumina [4-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
NOT|involved_in | GO:0045765 regulation of angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | |
NOT|involved_in | GO:1905203 regulation of connective tissue replacement |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | has_input UniProtKB:Q9QXX0 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | has_input UniProtKB:Q9QXX0 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | occurs_in CL:0000746 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | occurs_in UBERON:0000948 |
involved_in | GO:0045603 positive regulation of endothelial cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | |
involved_in | GO:0050714 positive regulation of protein secretion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | regulates_transport_of UniProtKB:Q00731 |
involved_in | GO:0051151 negative regulation of smooth muscle cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 | |
involved_in | GO:0060044 negative regulation of cardiac muscle cell proliferation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | |
involved_in | GO:0061052 negative regulation of cell growth involved in cardiac muscle cell development |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26976621 | |
involved_in | GO:1900239 regulation of phenotypic switching |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535084 |