Accession | MIMAT0003184 |
Description | mmu-miR-487b-3p mature miRNA |
Hairpins | |
Sequence | AAUCGUACAGGGUCAUCCACUU |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0001960 negative regulation of cytokine-mediated signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:Q8BVZ5 |
acts_upstream_of | GO:0002638 negative regulation of immunoglobulin production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30556842 | has_target_end_location UBERON:0001977 |
acts_upstream_of | GO:0008285 negative regulation of cell population proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30556842 | occurs_in CL:0000771 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:P06804 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:P08505 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:P29477 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:P42082 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_input UniProtKB:Q00609 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | has_output UniProtKB:P10749 |
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | |
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0032696 negative regulation of interleukin-13 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30556842 | has_target_end_location UBERON:0001977 |
acts_upstream_of | GO:0032713 negative regulation of interleukin-4 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30556842 | has_target_end_location UBERON:0001977 |
acts_upstream_of | GO:0032714 negative regulation of interleukin-5 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30556842 | has_target_end_location UBERON:0001977 |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | |
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0045344 negative regulation of MHC class I biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0045347 negative regulation of MHC class II biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0051245 negative regulation of cellular defense response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | |
acts_upstream_of | GO:0051771 negative regulation of nitric-oxide synthase biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0150128 negative regulation of interleukin-33 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0150141 negative regulation of CD86 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |
acts_upstream_of | GO:0150144 negative regulation of CD80 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26936882 | occurs_in CL:0002476 |