Accession | MIMAT0005451 |
Description | hsa-miR-522-5p mature miRNA |
Hairpins | |
Sequence | CUCUAGAGGGAAGCGCUUUCUG |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003674 molecular_function |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 | |
involved_in | GO:0008150 biological_process |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 | |
is_active_in | GO:0005575 cellular_component |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|