Accession | MIMAT0005476 |
Description | dme-miR-962-5p mature miRNA |
Hairpins | |
Sequence | AUAAGGUAGAGAAAUUGAUGCUGUC |
Evidence |
experimental
454 [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33477373 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33477373 | |
involved_in | GO:0006955 immune response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33477373 | |
involved_in | GO:0045751 negative regulation of Toll signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:33477373 | |
involved_in | GO:0045824 negative regulation of innate immune response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:33477373 | |
involved_in | GO:0060259 regulation of feeding behavior |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 |