MIR31 is a microRNA that has been shown to act as a tumor suppressor when transferred to HepG2 and primary hepatocarcinoma cells by HLSC-EVs [PMC8107725]. It is believed that MIR31 represses the expression of tumor suppressor genes, such as LATS2, and indirectly promotes the transcription of genes related to cell cycle control and tumorigenesis [PMC4067122]. Researchers have investigated the potential of modulating MIR31 using morpholino oligomers in a dystrophic context [PMC4972457]. MIR31, along with miR17-3p, has been found to regulate the expression of E-selectins and ICAM-1, reducing neutrophil adhesion and post-stroke leukocyte infiltration [PMC6732937]. Specific primers were used for amplifying MIR31 in experiments [PMC8906324]. It has been suggested that infected cells modulate the expression of certain microRNAs, including MIR31, which sustains CIITA expression [PMC9591123]. The MIR31 locus generates both MIR31 and a long non-coding RNA (lnc-MIR31) via mutually exclusive pathways [PMC4972457]. Comparison of all MIR31 outliers with non-outliers showed that MIR31 outliers were most similar to CMS4-mesenchymals in terms of biological characteristics [PMC6590447]. Additionally, WAVE3-targeting microRNAs provide further support for the function of WAVE3 as a metastasis-promoter gene [PMC3428347].
A G C -U gaa ggagagg GGCAA AUG UGGCAUAGC guu c ||||||| ||||| ||| ||||||||| ||| ccuuucU CCGUU UAC ACCGUAUCG caa u A A A Uc ggg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000089 |
Description | Homo sapiens hsa-miR-31-5p mature miRNA |
Sequence | 8 - AGGCAAGAUGCUGGCAUAGCU - 28 |
Evidence |
experimental
cloned [1-3], Northern [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004504 |
Description | Homo sapiens hsa-miR-31-3p mature miRNA |
Sequence | 44 - UGCUAUGCCAACAUAUUGCCAU - 65 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|