MIR370 is a microRNA that has been implicated in various cancers, including head and neck cancers, PCNSL, GC, and lung cancer. It has been shown to affect the prognosis of PCNSL patients and is considered a potential therapeutic target [PMC9428130]. In GC, the overexpression of MIR370 has been found to enhance cell proliferation, EMT, and invasion through the downregulation of UQCRC2 levels [PMC7378919]. MIR370 has also been shown to be regulated by IL-6 and DNMT1 in the context of GC [PMC5885281]. In lung cancer, MIR370 has been found to inhibit proliferation, angiogenesis, migration in vitro and growth and metastasis in vivo [PMC5675699]. It has also been shown to target EGFR expression [PMC5675699]. Additionally, MIR370 is involved in hematopoietic development and leukemogenesis by targeting FOXM1 [PMC7565099] [PMC6213964] [PMC3533721] [PMC9454643]. It is regulated by distinct gene expression programs on different chromosomes [PMC7565099'>PMC7565099]. Furthermore, MIR370 is known to downregulate the expression of MGMT through sequence complementarity with its mRNA [PMC7958331]. References: - PMC5354851 - PMC9428130 - PMC6158169 - PMC4998167 - PMC7378919 - PMC5885281 - PMC5011744 - PMC9373174 - PMC7565099 - PMC8065645 - PMC6183594
agaa CA U UUA agc agacag gcCAGGU CGUCUC GCAG Cac u |||||| ||||||| |||||| |||| ||| c ucuguc UGGUCCA GUGGGG CGUC Gug a ---- AG U --C agc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000722 |
Description | Homo sapiens hsa-miR-370-3p mature miRNA |
Sequence | 48 - GCCUGCUGGGGUGGAACCUGGU - 69 |
Evidence |
experimental
cloned [1-3], Illumina [4] |
Database links | |
Predicted targets |
Accession | MIMAT0026483 |
Description | Homo sapiens hsa-miR-370-5p mature miRNA |
Sequence | 13 - CAGGUCACGUCUCUGCAGUUAC - 34 |
Evidence |
experimental
Illumina [4] |
Database links | |
Predicted targets |
|