MIR3188 is a microRNA that has been found to regulate the mTOR and PI3K/AKT pathway involved in insulin signaling in endothelial cells [PMC8673831]. The reduced expression of MIR3188, due to the presence of rs7247237, has been associated with the development of type 2 diabetes mellitus (T2DM) [PMC8673831]. In nasopharyngeal carcinoma (NPC), MIR3188 is one of the downregulated miRNAs, and its decreased expression is associated with a good prognosis [PMC6368411]. Additionally, MIR3188 has been identified as a potential therapeutic target for non-small cell lung cancer (NSCLC) treatment [PMC6297856]. The functional importance of MIR3188 has been inferred using a systems biology tool called miRUPnet, which revealed that its target genes are critical in several cancer pathways and its most significant gene ontology term is chromatin binding [PMC4371809]. In iAs-T cells, the gene expression levels of OPN3 and MIR3188 were upregulated, but they were downregulated in iAs-Rev cells [PMC4371809]. Common genes found in all three conditions include microfibrillar associated protein 5 (MFAP5), phospholipase C-like 1 (PLCL1), opsin 3 (OPN3), and peroxisomal biogenesis factor 11 alpha (PEX11A) [PMC4371809]. Overall, MIR3188 plays important roles in insulin signaling, cancer prognosis, and potential therapeutic strategies for T2DM, NPC, NSCLC treatment. Accurate identification and quantification of intracellular MIR3188 are crucial for further research and prognosis of NPC [PMC8695942].
ggc u c g - c u cgc gccucc gcucug ugu ccgc cagggccuc cc ag g |||||| |||||| ||| |||| ||||||||| || || cggagg cGGGGC AUA GGCG GUUUCGGAG gg uc c -uc u - - U A - uuc
Accession | MIMAT0015070 |
Description | Homo sapiens hsa-miR-3188 mature miRNA |
Sequence | 53 - AGAGGCUUUGUGCGGAUACGGGG - 75 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|