Mature mmu-miR-30b-5p
| Accession | MIMAT0000130 |
| Description | mmu-miR-30b-5p mature miRNA |
| Hairpins | |
| Sequence | UGUAAACAUCCUACACUCAGCU |
| Evidence |
experimental
cloned [1-3], Illumina [4-5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30522932 | has_input UniProtKB:P54763 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30522932 | has_input UniProtKB:P54763 |
| involved_in | GO:0061886 negative regulation of mini excitatory postsynaptic potential |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30522932 | |
| involved_in | GO:1900272 negative regulation of long-term synaptic potentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30522932 | |
| involved_in | GO:1902951 negative regulation of dendritic spine maintenance |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30522932 | occurs_in CL:1001571 |
