Accession | MIMAT0000252 |
Description | hsa-miR-7-5p mature miRNA |
Hairpins | |
Sequence | UGGAAGACUAGUGAUUUUGUUGUU |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1900222 negative regulation of amyloid-beta clearance |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | occurs_in CL:0000540 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | has_input UniProtKB:P06213 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27203220 | has_input UniProtKB:Q04206 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27431648 | has_input UniProtKB:O43474 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | has_input UniProtKB:P06213 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27431648 | has_input UniProtKB:O43474 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31501273 | has_input UniProtKB:P06213 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27203220 | has_input UniProtKB:Q04206 |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:31501273 | |
involved_in | GO:1902532 negative regulation of intracellular signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27203220 | has_input UniProtKB:Q04206 |
involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27431648 | occurs_in CL:0002618 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18766170 | part_of UBERON:0001969 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|