Accession | MIMAT0000257 |
Description | hsa-miR-181b-5p mature miRNA |
Hairpins | |
Sequence | AACAUUCAUUGCUGUCGGUGGGU |
Evidence |
experimental
cloned [3-5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | has_input UniProtKB:P42262 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | has_input UniProtKB:P62760 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | has_input UniProtKB:Q9Y6W6 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25505240 | has_input UniProtKB:P25090 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535255 | has_input UniProtKB:P01375 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25762865 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | has_input UniProtKB:Q8WXG6 |
involved_in | GO:0009968 negative regulation of signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25505240 | occurs_in CL:0000235 |
involved_in | GO:0010917 negative regulation of mitochondrial membrane potential |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0030335 positive regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | has_input UniProtKB:P42262 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18184693 | has_input UniProtKB:P62760 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | has_input UniProtKB:Q9Y6W6 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25505240 | has_input UniProtKB:P25090 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27756793 | has_input UniProtKB:P35625 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27756793 | has_input UniProtKB:P15502 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28323882 | has_input UniProtKB:Q8WXG6 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23993976 | has_input UniProtKB:Q9Y6W6 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25762865 | has_input UniProtKB:P05231 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25535255 | has_input UniProtKB:P01375 |
involved_in | GO:0045429 positive regulation of nitric oxide biosynthetic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 | |
involved_in | GO:0045603 positive regulation of endothelial cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 | |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22232059 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|