Mature sequence dme-miR-288-3p

Accession numberMIMAT0000363
IDdme-miR-288-3p
Previous IDsdme-miR-288
Stem-Loop dme-mir-288
Sequence
uuucaugucgauuucauuucaug
Get sequence
Deep sequencing4 reads, 3 experiments
Predicted targets

References

1
PMID:12844358 "Computational identification of Drosophila microRNA genes" Lai EC, Tomancak P, Williams RW, Rubin GM Genome Biol. 4:R42(2003).