Mature dme-miR-306-5p
| Accession | MIMAT0000393 |
| Description | dme-miR-306-5p mature miRNA |
| Hairpins | |
| Sequence | UCAGGUACUUAGUGACUCUCAA |
| Evidence |
experimental
cloned [1], 454 [2-3], Illumina [3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0046330 positive regulation of JNK cascade |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36222503 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31112748 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23154414 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31112748 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:36222503 | |
| involved_in | GO:0032435 negative regulation of proteasomal ubiquitin-dependent protein catabolic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:36222503 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23154414 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31112748 | |
| involved_in | GO:0035220 wing disc development |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:31112748 | |
| involved_in | GO:0036098 male germ-line stem cell population maintenance |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23154414 |
