Accession | MIMAT0000450 |
Description | hsa-miR-149-5p mature miRNA |
Hairpins | |
Sequence | UCUGGCUCCGUGUCUUCACUCCC |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | |
acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | |
acts_upstream_of | GO:1903588 negative regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | occurs_in CL:0002618 |
acts_upstream_of | GO:2000545 negative regulation of endothelial cell chemotaxis to fibroblast growth factor |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P09038 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P11362 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P35052 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25916550 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26498692 | has_input UniProtKB:P49593 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29331391 | has_input UniProtKB:P09651 |
involved_in | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25916550 | |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26498692 | |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24299952 | occurs_in CL:0002618 |
involved_in | GO:0032916 positive regulation of transforming growth factor beta3 production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0000057 |
involved_in | GO:0032967 positive regulation of collagen biosynthetic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0000057 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23595570 | has_input UniProtKB:P05231 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24299952 | has_input UniProtKB:P14780 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P11362 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P35052 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25916550 | has_input UniProtKB:P05231 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26498692 | has_input UniProtKB:P49593 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29331391 | has_input UniProtKB:P09651 |
involved_in | GO:0040037 negative regulation of fibroblast growth factor receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | occurs_in CL:0002544 |
involved_in | GO:0044344 cellular response to fibroblast growth factor stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24463821 | has_input UniProtKB:P09038 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0001003 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|