Accession | MIMAT0000457 |
Description | hsa-miR-188-5p mature miRNA |
Hairpins | |
Sequence | CAUCCCUUGCAUGGUGGAGGG |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28640956 | has_input UniProtKB:Q99759 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28640956 | has_input UniProtKB:Q99759 |
involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:28640956 | occurs_in CL:0002092 |
involved_in | GO:1903769 negative regulation of cell proliferation in bone marrow |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28640956 | |
involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28640956 | occurs_in CL:0002092 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|