Mature mmu-let-7a-5p
| Accession | MIMAT0000521 |
| Description | mmu-let-7a-5p mature miRNA |
| Hairpins | |
| Sequence | UGAGGUAGUAGGUUGUAUAGUU |
| Evidence |
experimental
cloned [1-4], Illumina [5,7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30467960 | occurs_in CL:0002543 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30467960 | has_input UniProtKB:O88393 |
| involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30467960 | occurs_in CL:0002543 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30467960 | has_input UniProtKB:O88393 |
