Accession | MIMAT0000733 |
Description | hsa-miR-379-5p mature miRNA |
Hairpins | |
Sequence | UGGUAGACUAUGGAACGUAGG |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26944318 | has_input UniProtKB:Q05397 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26944318 | has_input UniProtKB:Q05397 |
involved_in | GO:0010633 negative regulation of epithelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26944318 | |
involved_in | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26944318 | |
involved_in | GO:0032868 response to insulin |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0002107 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26944318 | has_input UniProtKB:Q05397 |
involved_in | GO:0070328 triglyceride homeostasis |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0001969 |
involved_in | GO:0110119 positive regulation of very-low-density lipoprotein particle clearance |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25510864 | occurs_in UBERON:0002107 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|