Mature sequence osa-miR399a

Accession numberMIMAT0000984
IDosa-miR399a
Stem-Loop osa-MIR399a
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing6 reads, 2 experiments
Database links
QuickGO function

References

1