Mature sequence ath-miR405a

Accession numberMIMAT0001006
IDath-miR405a
Stem-Loop ath-MIR405a
Sequence
augaguugggucuaacccauaacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).